Transim is a command-line utility that implements a comprehensive sequence-based biophysical model of translation initiation and elongation in prokaryotes. It is intended for researchers who seek to forecast translation properties based on the RNA sequence.
Transim is a utility available for ad-hoc results as well as large-scale analysis. Learn about the options available and how to use this utility.
Transim is freely available for academic use. Download Transim to analyze the impact of translation as part of your research.
In case you are using our software or results for your publications please cite:
Shaham, G. and Tuller, T. (2017) Genome scale analysis of Escherichia coli with a comprehensive prokaryotic sequence-based biophysical model of translation initiation and elongation, DNA Research. doi:10.1093/dnares/dsx049.
In most cases it would be sufficient to provide the mRNA start position and the mRNA sequence that includes at least the 5'UTR and the ORF. Set the start position by specifying the -s or --startpos argument. For Example:
transim -s 32 GCATTCATAACCCGATCCATCTGGAGGAACTAATGGATCATCGTCTGCTTGAAATCATTGCCTGCCCGGTTTGCAACGGAAAACTTTGGTATAACCAGGAAAAACAAGAGCTTATTTGCAAACTGGACAACCTCGCTTTCCCGCTGCGTGATGGCATTCCAGTGTTGCTGGAAACGGAAGCCCGCGTGCTGACTGCTGATGAGAGTAAATCATGA
The output result is CSV text with the following columns:
| Column name | Description |
|---|---|
| line | The original command line, appears only if there was some error in the execution, otherwise empty. |
| mRNA | The mRNA sequence. |
| name | The user-provided name of this execution. |
| startpos | The position where the ORF starts (0 is the first nucleotide of the mRNA) |
| mRnaDg | The Gibbs free energy of the mRNA. |
| startDg | The Gibbs free energy of the start codon. |
| mRna_rRnaDg | The Gibbs free energy of the mRNA:rRNA |
| standbyDg | The standby Gibbs free energy. |
| spacingDg | The spacing Gibbs free energy. |
| totalDg | The total Gibbs free energy. |
| initRate | The calculated initiation rate before normalization. |
| structure | The resultant structure in bracket notation where the ’&’ character splits the mRNA and rRNA. |
| normalizedInitRate | The initiation rate normalized to [s-1] units. |
| meanElongation | The mean elongation rate of the mRNA sequence. |
| numSites | The number of sites (number of codons) in the ORF. |
| tasep.iter1 | The number of iterations performed by TASEP prior to measuring results. |
| tasep.term1 | The number of ribosome terminations that occurred by TASEP prior to measuring results. |
| tasep.iter2 | The number of iterations performed by TASEP while measuring the results. |
| tasep.term2 | The number of ribosome terminations that occurred by TASEP while measuring the results. |
| tasep.time2 | The total time ribosome movement was measured by TASEP. |
| tasep.initJamOccurrences | The number of ribosome jams that occurred during initiation. |
| tasep.initJamTime | The total time lost during initiation due to ribosome jams. |
| tasep.jamOccurrences | The number of ribosome jams that occurred during elongation. |
| tasep.meanJamTime | The mean time lots due to ribosome jams during elongation. |
| meanRiboNum | The mean number of ribosomes on the ORF. |
| translationRate | The translation rate. |
| density | The mean ribosome density. |
| densityArray | Per-codon mean ribosome density. This column is empty unless the verbose option is enabled. |
| jamOccurrencesArray | Per-codon ribosome jam occurrences. This column is empty unless the verbose option is enabled. |
| jamTimeArray | Per-codon ribosome jam time. This column is empty unless the verbose option is enabled. |
| status | ’OK’ if no error occurred, otherwise ’Error’. |
| message | If error occurred, contains an error message. |
Note that all the argument names are case sensitive.
If you do not know the ORF start position, you do not need to include the -s or --startpos argument. Transim will look for all possible ORFs (start codon and stop codon within the same frame) and calculate all results. Each result will be in a new output row. By default, all ORF results include cases where no suitable binding site was found. You can specify -S or --suppressOrfSearchWitoutBinding to exclude those cases from the output.
You can add a name for each row by specifying the -N or --name argument. This is useful when you have multiple executions and would like to later process the CSV file.
For example:
transim -N ycaR -s 32 GCATTCATAACCCGATCCATCTGGAGGAACTAATGGATCATCGTCTGCTTGAAATCATTGCCTGCCCGGTTTGCAACGGAAAACTTTGGTATAACCAGGAAAAACAAGAGCTTATTTGCAAACTGGACAACCTCGCTTTCCCGCTGCGTGATGGCATTCCAGTGTTGCTGGAAACGGAAGCCCGCGTGCTGACTGCTGATGAGAGTAAATCATGA
TASEP is performed in two passes. The first pass does not measure the results (e.g., the translation rate). This is useful if you would like to first bring the ribosomes to steady state. The second pass performs the measurements and reports them in the output. By default the first pass is executed with 100,000 iterations and the second pass is executed with 1,000,000 iterations. You can control the number of iterations in the first pass by specifying the -i1 or --iteration1 argument followed by the number of required iterations in the first pass and specify -i2 or --iteration2 argument for the number of iterations in the second pass.
You can also control the number of ribosome termination events by specifying -n1 or --term1 for the first pass and -n2 or --term2 for the second pass. Furthermore -t2 or --time2 sets the total time the ribosome perform translation during the second pass (note that this is not the time the software executes, but rather the time it simulates).
All arguments can be combined, each pass terminates when the first constraint is met. For example, to terminate the first pass after 10,000 iterations or 100 terminations (the earliest of the two):
transim -i1 10000 -n1 100 -N ycaR -s 32 GCATTCATAACCCGATCCATCTGGAGGAACTAATGGATCATCGTCTGCTTGAAATCATTGCCTGCCCGGTTTGCAACGGAAAACTTTGGTATAACCAGGAAAAACAAGAGCTTATTTGCAAACTGGACAACCTCGCTTTCCCGCTGCGTGATGGCATTCCAGTGTTGCTGGAAACGGAAGCCCGCGTGCTGACTGCTGATGAGAGTAAATCATGA
It is possible to measure and report results per-codon position. By specifying the -V or --verbose argument, the output will include the density, jam occurrences and jam time per each codon position.
transim -V -N ycaR -s 32 GCATTCATAACCCGATCCATCTGGAGGAACTAATGGATCATCGTCTGCTTGAAATCATTGCCTGCCCGGTTTGCAACGGAAAACTTTGGTATAACCAGGAAAAACAAGAGCTTATTTGCAAACTGGACAACCTCGCTTTCCCGCTGCGTGATGGCATTCCAGTGTTGCTGGAAACGGAAGCCCGCGTGCTGACTGCTGATGAGAGTAAATCATGA
It is possible to use a file as input instead of command line arguments by specifying the -f or --file argument followed by the file name. For Example:
transim -f myinput.txt
The file is in text format, where for in each line you can specify the same arguments accepted by the command line and the mRNA sequence. In the previous example myinput.txt can contain the following lines:
-N ycaR -s 32 GCATTCATAACCCGATCCATCTGGAGGAACTAATGGATCATCGTCTGCTTGAAATCATTGCCTGCCCGGTTTGCAACGGAAAACTTTGGTATAACCAGGAAAAACAAGAGCTTATTTGCAAACTGGACAACCTCGCTTTCCCGCTGCGTGATGGCATTCCAGTGTTGCTGGAAACGGAAGCCCGCGTGCTGACTGCTGATGAGAGTAAATCATGA -N mgsA -s 27 AGGAAAGTTAACTACGGATGTACATTAATGGAACTGACGACTCGCACTTTACCTGCGCGGAAACATATTGCGCTGGTGGCACACGATCACTGCAAACAAATGCTGATGAGCTGGGTGGAACGGCATCAACCGTTACTGGAACAACACGTACTGTATGCAACAGGCACTACCGGTAACTTAATTTCCCGCGCGACCGGCATGAACGTCAACGCGATGTTGAGTGGCCCAATGGGGGGTGACCAGCAGGTTGGCGCATTGATCTCAGAAGGGAAAATTGATGTATTGATTTTCTTCTGGGATCCACTAAATGCCGTGCCGCACGATCCTGACGTGAAAGCCTTGCTGCGTCTGGCGACGGTATGGAACATTCCGGTCGCCACCAACGTGGCAACGGCAGACTTCATAATCCAGTCGCCGCATTTCAACGACGCGGTCGATATTCTGATCCCCGATTATCAGCGTTATCTCGCGGACCGTCTGAAGTAA -N hicA -s 66 AAATTACACACGGAGGTAAACACTAATGTTTACTTTGTTGATATACTCAGCGGCAGGGAGGCGATGGTGAAACAAAGCGAGTTCAGACGTTGGCTCGAATCTCAGGGCGTCGATGTAGCGAATGGCAGCAACCATTTGAAACTCAGGTTTCATGGGAGGCGCAGTGTCATGCCGCGTCACCCCTGCGATGAGATTAAAGAACCATTGCGTAAAGCAATCCTGAAACAACTCGGTTTGAGTTAA
With this input file, Transim output will be CSV format with 3 result lines where each line can be identified by the name specified by the -N argument.
Use the -h or --help argument for a complete listing of the command line arguments available.
Transim is available for Windows and a few Linux distributions. Transim is available for academic use only.
Transim package includes pre-compiled portions of ViennaRNA version 2.2.7 available from the Institute for Theoretical Chemistry of the University of Vienna. You may compile and replace the files in the ViennaRNA folder with a newer version.